Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV.
The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been...
- Autores:
-
Ramos Hernández, Eder
Lesher Gordillo, María Juliana
Ortiz García, Carlos Fredy
Oropeza Salín, Carlos
Sánchez Soto, Saúl
Magaña Alejandro, Miguel Ángel
Narváez C., María del S.
- Tipo de recurso:
- Article of journal
- Fecha de publicación:
- 2020
- Institución:
- Universidad del Valle
- Repositorio:
- Repositorio Digital Univalle
- Idioma:
- eng
- OAI Identifier:
- oai:bibliotecadigital.univalle.edu.co:10893/20824
- Acceso en línea:
- https://hdl.handle.net/10893/20824
- Palabra clave:
- Palmas
PCR tiempo real
Vector de fitoplasma
Haplaxius crudus
Haplaxius skarphion
Oecleus snowi
Persis foveatis
Cixiidae
Derbidae
Hemiptera
- Rights
- openAccess
- License
- http://purl.org/coar/access_right/c_abf2
Summary: | The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms. |
---|