Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch

ilustraciones, fotografías

Autores:
Gaete Carrillo, Paula Valentina
Tipo de recurso:
Fecha de publicación:
2022
Institución:
Universidad Nacional de Colombia
Repositorio:
Universidad Nacional de Colombia
Idioma:
spa
OAI Identifier:
oai:repositorio.unal.edu.co:unal/84109
Acceso en línea:
https://repositorio.unal.edu.co/handle/unal/84109
https://repositorio.unal.edu.co/
Palabra clave:
610 - Medicina y salud
Síndrome de Beckwith-Wiedemann
Beckwith-Wiedemann Syndrome
Deoxyribonucleic acid DNA
Genetic code
ADN
Código genético
síndromes progeroides
Envejecimiento
Empalme
Intrones
p53
Rights
openAccess
License
Reconocimiento 4.0 Internacional
id UNACIONAL2_9fb96c2b6b931169e303234e28bf5bb7
oai_identifier_str oai:repositorio.unal.edu.co:unal/84109
network_acronym_str UNACIONAL2
network_name_str Universidad Nacional de Colombia
repository_id_str
dc.title.spa.fl_str_mv Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
dc.title.translated.eng.fl_str_mv Intron retention analysis and differential expression analysis of p53 isoforms in fibroblasts from patients with Wiedemann-Rautenstrauch Syndrome
title Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
spellingShingle Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
610 - Medicina y salud
Síndrome de Beckwith-Wiedemann
Beckwith-Wiedemann Syndrome
Deoxyribonucleic acid DNA
Genetic code
ADN
Código genético
síndromes progeroides
Envejecimiento
Empalme
Intrones
p53
title_short Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
title_full Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
title_fullStr Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
title_full_unstemmed Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
title_sort Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-Rautenstrauch
dc.creator.fl_str_mv Gaete Carrillo, Paula Valentina
dc.contributor.advisor.none.fl_str_mv Arboleda Bustos, Gonzalo
dc.contributor.author.none.fl_str_mv Gaete Carrillo, Paula Valentina
dc.contributor.researchgroup.spa.fl_str_mv Grupo de Muerte Celular - Universidad Nacional de Colombia
dc.contributor.orcid.spa.fl_str_mv Paula Valentina Gaete Carrillo, 0000-0001-9387-6017
dc.contributor.cvlac.spa.fl_str_mv https://scienti.minciencias.gov.co/cvlac/visualizador/generarCurriculoCv.do?cod_rh=0000097625
dc.contributor.researchgate.spa.fl_str_mv https://www.researchgate.net/profile/Paula-Gaete
dc.contributor.googlescholar.spa.fl_str_mv https://scholar.google.com/citations?user=Wd5n4WQAAAAJ&hl=es&authuser=1
dc.subject.ddc.spa.fl_str_mv 610 - Medicina y salud
topic 610 - Medicina y salud
Síndrome de Beckwith-Wiedemann
Beckwith-Wiedemann Syndrome
Deoxyribonucleic acid DNA
Genetic code
ADN
Código genético
síndromes progeroides
Envejecimiento
Empalme
Intrones
p53
dc.subject.decs.spa.fl_str_mv Síndrome de Beckwith-Wiedemann
dc.subject.decs.eng.fl_str_mv Beckwith-Wiedemann Syndrome
dc.subject.lemb.eng.fl_str_mv Deoxyribonucleic acid DNA
Genetic code
dc.subject.lemb.spa.fl_str_mv ADN
Código genético
dc.subject.proposal.spa.fl_str_mv síndromes progeroides
Envejecimiento
Empalme
Intrones
p53
description ilustraciones, fotografías
publishDate 2022
dc.date.issued.none.fl_str_mv 2022-12-16
dc.date.accessioned.none.fl_str_mv 2023-06-29T16:43:47Z
dc.date.available.none.fl_str_mv 2023-06-29T16:43:47Z
dc.type.spa.fl_str_mv Trabajo de grado - Maestría
dc.type.driver.spa.fl_str_mv info:eu-repo/semantics/masterThesis
dc.type.version.spa.fl_str_mv info:eu-repo/semantics/acceptedVersion
dc.type.content.spa.fl_str_mv Text
dc.type.redcol.spa.fl_str_mv http://purl.org/redcol/resource_type/TM
status_str acceptedVersion
dc.identifier.uri.none.fl_str_mv https://repositorio.unal.edu.co/handle/unal/84109
dc.identifier.instname.spa.fl_str_mv Universidad Nacional de Colombia
dc.identifier.reponame.spa.fl_str_mv Repositorio Institucional Universidad Nacional de Colombia
dc.identifier.repourl.spa.fl_str_mv https://repositorio.unal.edu.co/
url https://repositorio.unal.edu.co/handle/unal/84109
https://repositorio.unal.edu.co/
identifier_str_mv Universidad Nacional de Colombia
Repositorio Institucional Universidad Nacional de Colombia
dc.language.iso.spa.fl_str_mv spa
language spa
dc.relation.references.spa.fl_str_mv Abascal-Palacios, G., Ramsay, E. P., Beuron, F., Morris, E., & Vannini, A. (2018). Structural basis of RNA polymerase III transcription initiation. Nature, 553(7688), 301-306.
Adusumalli, S., Ngian, Z. K., Lin, W. Q., Benoukraf, T., & Ong, C. T. (2019). Increased intron retention is a post‐transcriptional signature associated with progressive aging and Alzheimer’s disease. Aging cell, 18(3), e12928.
Amaya-Montoya, M., Pérez-Londoño, A., Guatibonza-García, V., Vargas-Villanueva, A., & Mendivil, C. O. (2020). Cellular senescence as a therapeutic target for age-related diseases: a review. Advances in therapy, 37(4), 1407-1424.
Arboleda, G., Ramírez, N., & Arboleda, H. (2007). The neonatal progeroid syndrome (Wiedemann–Rautenstrauch): A model for the study of human aging?. Experimental gerontology, 42(10), 939-943.
Baez-Becerra, C. T., Valencia-Rincón, E., Velásquez-Méndez, K., Ramírez-Suárez, N. J., Guevara, C., Sandoval-Hernandez, A., ... & Arboleda, G. (2020). Nucleolar disruption, activation of P53 and premature senescence in POLR3A-mutated Wiedemann-Rautenstrauch Syndrome fibroblasts. Mechanisms of Ageing and Development, 192, 111360.
Bhadra, M., Howell, P., Dutta, S., Heintz, C., & Mair, W. B. (2020). Alternative splicing in aging and longevity. Human genetics, 139(3), 357-369.
Bourdon, J. C., Fernandes, K., Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas, D. P., ... & Lane, D. P. (2005). p53 isoforms can regulate p53 transcriptional activity. Genes & development, 19(18), 2122-2137.
Carrero, D., Soria-Valles, C., & López-Otín, C. (2016). Hallmarks of progeroid syndromes: lessons from mice and reprogrammed cells. Disease models & mechanisms, 9(7), 719-735.
Chan, W. M., & Poon, R. Y. (2007). The p53 isoform Δp53 lacks intrinsic transcriptional activity and reveals the critical role of nuclear import in dominant-negative activity. Cancer research, 67(5), 1959-1969.
Chen, J., Zhang, D., Qin, X., Owzar, K., McCann, J. J., & Kastan, M. B. (2021). Dna-damage-induced alternative splicing of p53. Cancers, 13(2), 251.
Christensen, K., Doblhammer, G., Rau, R., & Vaupel, J. W. (2009). Ageing populations: the challenges ahead. The lancet, 374(9696), 1196-1208.
Deschênes, M., & Chabot, B. (2017). The emerging role of alternative splicing in senescence and aging. Aging cell, 16(5), 918-933.
Didychuk, A. L., Butcher, S. E., & Brow, D. A. (2018). The life of U6 small nuclear RNA, from cradle to grave. RNA, 24(4), 437-460.
Dvinge, H., Guenthoer, J., Porter, P. L., & Bradley, R. K. (2019). RNA components of the spliceosome regulate tissue-and cancer-specific alternative splicing. Genome research, 29(10), 1591-1604.
Faustino, N. A., & Cooper, T. A. (2003). Pre-mRNA splicing and human disease. Genes & development, 17(4), 419-437.
Fujita, K. (2019). P53 isoforms in cellular senescence-and ageing-associated biological and physiological functions. International journal of molecular sciences, 20(23), 6023.
Fujita, K., Mondal, A. M., Horikawa, I., Nguyen, G. H., Kumamoto, K., Sohn, J. J., ... & Harris, C. C. (2009). p53 isoforms Δ133p53 and p53β are endogenous regulators of replicative cellular senescence. Nature cell biology, 11(9), 1135-1142.
Gadea, G., Arsic, N., Fernandes, K., Diot, A., Joruiz, S. M., Abdallah, S., ... & Roux, P. (2016). TP53 drives invasion through expression of its Δ133p53β variant. Elife, 5, e14734.
García‐Alai, M. M., Tidow, H., Natan, E., Townsley, F. M., Veprintsev, D. B., & Fersht, A. R. (2008). The novel p53 isoform “delta p53” is a misfolded protein and does not bind the p21 promoter site. Protein Science, 17(10), 1671-1678.
Gudikote, J. P., Cascone, T., Poteete, A., Sitthideatphaiboon, P., Wu, Q., Morikawa, N., ... & Heymach, J. V. (2021). Inhibition of nonsense-mediated decay rescues p53β/γ isoform expression and activates the p53 pathway in MDM2-overexpressing and select p53-mutant cancers. Journal of Biological Chemistry, 297(5).
Harries, L. W., Hernandez, D., Henley, W., Wood, A. R., Holly, A. C., Bradley‐Smith, R. M., ... & Melzer, D. (2011). Human aging is characterized by focused changes in gene expression and deregulation of alternative splicing. Aging cell, 10(5), 868-878.
Heintz, C., Doktor, T. K., Lanjuin, A., Escoubas, C. C., Zhang, Y., Weir, H. J., ... & Mair, W. B. (2017). Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans. Nature, 541(7635), 102-106.
Holly, A. C., Melzer, D., Pilling, L. C., Fellows, A. C., Tanaka, T., Ferrucci, L., & Harries, L. W. (2013). Changes in splicing factor expression are associated with advancing age in man. Mechanisms of ageing and development, 134(9), 356-366.
Horikawa, I., Park, K. Y., Isogaya, K., Hiyoshi, Y., Li, H., Anami, K., ... & Harris, C. C. (2017). Δ133p53 represses p53-inducible senescence genes and enhances the generation of human induced pluripotent stem cells. Cell Death & Differentiation, 24(6), 1017-1028.
Howe, M. P., Crerar, H., Neeves, J., Harley, J., Tyzack, G. E., Klein, P., ... & Luisier, R. (2022). Physiological intron retaining transcripts in the cytoplasm abound during human motor neurogenesis. Genome Research, 32(10), 1808-1825.
Joruiz, S. M., & Bourdon, J. C. (2016). p53 isoforms: key regulators of the cell fate decision. Cold Spring Harbor perspectives in medicine, 6(8), a026039.
Kulaberoglu, Y., Malik, Y., Borland, G., Selman, C., Alic, N., & Tullet, J. M. (2021). RNA polymerase III, ageing and longevity. Frontiers in Genetics, 12.
Khoury, M. P., & Bourdon, J. C. (2011). p53 isoforms: an intracellular microprocessor?. Genes & cancer, 2(4), 453-465.
Khoury, M. P., Marcel, V., Fernandes, K., Diot, A., Lane, D. P., & Bourdon, J. C. (2013). Detecting and quantifying p53 isoforms at mRNA level in cell lines and tissues. In p53 Protocols (pp. 1-14). Humana Press, Totowa, NJ.
Kim, S., & An, S. S. A. (2016). Role of p53 isoforms and aggregations in cancer. Medicine, 95(26).
Kumari, R., & Jat, P. (2021). Mechanisms of cellular senescence: cell cycle arrest and senescence associated secretory phenotype. Frontiers in Cell and Developmental Biology, 9, 485.
Lee, Y., & Rio, D. C. (2015). Mechanisms and regulation of alternative pre-mRNA splicing. Annual review of biochemistry, 84, 291-323.
Liu, S., Hua, Y., Wang, J., Li, L., Yuan, J., Zhang, B., ... & Kong, D. (2021). RNA polymerase III is required for the repair of DNA double-strand breaks by homologous recombination. Cell, 184(5), 1314-1329.
López-Otín, C., Blasco, M. A., Partridge, L., Serrano, M., & Kroemer, G. (2013). The hallmarks of aging. Cell, 153(6), 1194-1217.
Marcel, V., Perrier, S., Aoubala, M., Ageorges, S., Groves, M. J., Diot, A., ... & Bourdon, J. C. (2010). Δ160p53 is a novel N-terminal p53 isoform encoded by Δ133p53 transcript. FEBS letters, 584(21), 4463-4468.
Mariotti, M., Kerepesi, C., Oliveros, W., Mele, M., & Gladyshev, V. N. (2022). Deterioration of the human transcriptome with age due to increasing intron retention and spurious splicing. bioRxiv.
Middleton, R., Gao, D., Thomas, A., Singh, B., Au, A., Wong, J. J., ... & Ritchie, W. (2017). IRFinder: assessing the impact of intron retention on mammalian gene expression. Genome biology, 18(1), 1-11.
Mondal, A. M., Horikawa, I., Pine, S. R., Fujita, K., Morgan, K. M., Vera, E., ... & Harris, C. C. (2013). p53 isoforms regulate aging-and tumor-associated replicative senescence in T lymphocytes. The Journal of clinical investigation, 123(12), 5247-5257.
Okada, N., Oshima, K., Iwasaki, Y., Maruko, A., Matsumura, K., Iioka, E., ... & Nishimura, S. (2021). Intron retention as a new pre-symptomatic marker of aging and its recovery to the normal state by a traditional Japanese multi-herbal medicine. Gene, 794, 145752.
Paolacci, S., Bertola, D., Franco, J., Mohammed, S., Tartaglia, M., Wollnik, B., & Hennekam, R. C. (2017). Wiedemann–Rautenstrauch syndrome: a phenotype analysis. American Journal of Medical Genetics Part A, 173(7), 1763-1772.
Paolacci, S., Li, Y., Agolini, E., Bellacchio, E., Arboleda-Bustos, C. E., Carrero, D., ... & Hennekam, R. C. (2018). Specific combinations of biallelic POLR3A variants cause Wiedemann-Rautenstrauch syndrome. Journal of medical genetics, 55(12), 837-846.
Petr, M. A., Tulika, T., Carmona-Marin, L. M., & Scheibye-Knudsen, M. (2020). Protecting the aging genome. Trends in Cell Biology, 30(2), 117-132.
Singh, R. K., & Cooper, T. A. (2012). Pre-mRNA splicing in disease and therapeutics. Trends in molecular medicine, 18(8), 472-482.
Tiku, V., & Antebi, A. (2018). Nucleolar function in lifespan regulation. Trends in cell biology, 28(8), 662-672.
Turnquist, C., Horikawa, I., Foran, E., Major, E. O., Vojtesek, B., Lane, D. P., ... & Harris, C. C. (2016). p53 isoforms regulate astrocyte-mediated neuroprotection and neurodegeneration. Cell Death & Differentiation, 23(9), 1515-1528.
Vanichkina, D. P., Schmitz, U., Wong, J. J. L., & Rasko, J. E. (2018, March). Challenges in defining the role of intron retention in normal biology and disease. In Seminars in cell & developmental biology (Vol. 75, pp. 40-49). Academic Press.
Vasileiou, P. V., Evangelou, K., Vlasis, K., Panayiotidis, M. I., Chronopoulos, E., Passias, P. G., ... & Havaki, S. (2019). Mitochondrial homeostasis and cellular senescence. Cells, 8(7), 686.
Vieler, M., & Sanyal, S. (2018). p53 isoforms and their implications in cancer. Cancers, 10(9), 288.
von Muhlinen, N., Horikawa, I., Alam, F., Isogaya, K., Lissa, D., Vojtesek, B., ... & Harris, C. C. (2018). p53 isoforms regulate premature aging in human cells. Oncogene, 37(18), 2379-2393. .
Wang, E. T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., ... & Burge, C. B. (2008). Alternative isoform regulation in human tissue transcriptomes. Nature, 456(7221), 470-476.
Yang, K., Wang, M., Zhao, Y., Sun, X., Yang, Y., Li, X., ... & Yi, J. (2016). A redox mechanism underlying nucleolar stress sensing by nucleophosmin. Nature communications, 7(1), 1-16.
Yao, J., Ding, D., Li, X., Shen, T., Fu, H., Zhong, H., ... & Ni, T. (2020). Prevalent intron retention fine‐tunes gene expression and contributes to cellular senescence. Aging Cell, 19(12), e13276.
Zheng, J. T., Lin, C. X., Fang, Z. Y., & Li, H. D. (2020). Intron retention as a mode for RNA-seq data analysis. Frontiers in Genetics, 11, 586.
dc.rights.coar.fl_str_mv http://purl.org/coar/access_right/c_abf2
dc.rights.license.spa.fl_str_mv Reconocimiento 4.0 Internacional
dc.rights.uri.spa.fl_str_mv http://creativecommons.org/licenses/by/4.0/
dc.rights.accessrights.spa.fl_str_mv info:eu-repo/semantics/openAccess
rights_invalid_str_mv Reconocimiento 4.0 Internacional
http://creativecommons.org/licenses/by/4.0/
http://purl.org/coar/access_right/c_abf2
eu_rights_str_mv openAccess
dc.format.extent.spa.fl_str_mv xvii, 52 páginas
dc.format.mimetype.spa.fl_str_mv application/pdf
dc.publisher.spa.fl_str_mv Universidad Nacional de Colombia
dc.publisher.program.spa.fl_str_mv Bogotá - Medicina - Maestría en Genética Humana
dc.publisher.faculty.spa.fl_str_mv Facultad de Medicina
dc.publisher.place.spa.fl_str_mv Bogotá,Colombia
dc.publisher.branch.spa.fl_str_mv Universidad Nacional de Colombia - Sede Bogotá
institution Universidad Nacional de Colombia
bitstream.url.fl_str_mv https://repositorio.unal.edu.co/bitstream/unal/84109/1/license.txt
https://repositorio.unal.edu.co/bitstream/unal/84109/2/1026590616.2023.pdf
https://repositorio.unal.edu.co/bitstream/unal/84109/3/1026590616.2023.pdf.jpg
bitstream.checksum.fl_str_mv eb34b1cf90b7e1103fc9dfd26be24b4a
f975f25290e0cc1d82b07bd477e83352
84f452cb9e49f4fbdb2ff4f34492fea0
bitstream.checksumAlgorithm.fl_str_mv MD5
MD5
MD5
repository.name.fl_str_mv Repositorio Institucional Universidad Nacional de Colombia
repository.mail.fl_str_mv repositorio_nal@unal.edu.co
_version_ 1806886297478889472
spelling Reconocimiento 4.0 Internacionalhttp://creativecommons.org/licenses/by/4.0/info:eu-repo/semantics/openAccesshttp://purl.org/coar/access_right/c_abf2Arboleda Bustos, Gonzalo44ac69a302db6956f8af251f7a88f515Gaete Carrillo, Paula Valentina4b23097cf854561ccc6b550a9ac0d2d3Grupo de Muerte Celular - Universidad Nacional de ColombiaPaula Valentina Gaete Carrillo, 0000-0001-9387-6017https://scienti.minciencias.gov.co/cvlac/visualizador/generarCurriculoCv.do?cod_rh=0000097625https://www.researchgate.net/profile/Paula-Gaetehttps://scholar.google.com/citations?user=Wd5n4WQAAAAJ&hl=es&authuser=12023-06-29T16:43:47Z2023-06-29T16:43:47Z2022-12-16https://repositorio.unal.edu.co/handle/unal/84109Universidad Nacional de ColombiaRepositorio Institucional Universidad Nacional de Colombiahttps://repositorio.unal.edu.co/ilustraciones, fotografíasObjetivo: El objetivo de esta investigación fue evaluar el impacto de variantes patogénicas en la ARN Polimerasa III subunidad A (POLR3A) sobre la retención de intrones y la expresión relativa del ARN corto nuclear U6 y de diferentes isoformas de p53 en fibroblastos derivados de pacientes con Síndrome de Wiedemann-Rautenstrauch (SWR). Metodología: Se realizó un cultivo primario de fibroblastos de dos pacientes con Síndrome de Wiedemann-Rautenstrauch (SWR) y de un control sano. Se extrajo el ARN de los fibroblastos por medio de TRIzol. A partir del ARN extraído se midió la expresión de 6 isoformas de p53, del ARN corto nuclear U6 y de genes relacionados con la senescencia celular por medio de RT-PCR. Adicionalmente se realizó un secuenciamiento global de ARN mensajero (RNA-Seq) y se analizó la retención de intrones utilizando el programa IRFinder. Resultados y conclusiones: En el análisis de retención de intrones no se encontraron diferencias marcadas en el porcentaje de retención de intrones (control: 7.8%, WRS1: 6.3% y WRS2: 8.14%). Los genes con mayor retención de intrones están relacionados principalmente con vías relacionadas con la unión al ARN, la regulación del ciclo celular, regulación positiva de la transcripción, regulación positiva de vías relacionadas con la inflamación, regulación negativa de la apoptosis, transcripción del ARN, mitocondria y regulación del inicio de la traducción. Los genes con mayor retención de intrones en los pacientes se relacionan con la respuesta inmune y la función mitocondrial, mientras que los que retuvieron más intrones en el control se relacionan con la respuesta al estrés oxidativo. La paciente WRS1 mostró una mayor expresión de ARN corto nuclear U6 comparada con el control y con la paciente WRS2. Los fibroblastos de las pacientes con SWR expresaron un mayor porcentaje de p53 y un menor porcentaje de 133p53 concordante con una mayor expresión de los marcadores de senescencia celular p16 y p21. Estos resultados resaltan la importancia de la función de la ARN polimerasa III en el mantenimiento de la homeostasis celular, principalmente en los procesos de empalme y de reparación del ADN. (Texto tomado de la fuente)Aim: The aim of this study was to evaluate the impact of pathogenic variants in RNA Polymerase III subunit A (POLR3A) on intron retention and on the relative expression of the short nuclear RNA U6 and of different p53 isoforms in fibroblasts derived from patients with Wiedemann-Rautenstrauch Syndrome (WRS). Methods: Primary culture of fibroblasts from two patients with Wiedemann-Rautenstrauch Syndrome (WWS) and a healthy control was performed. RNA was extracted from fibroblasts using TRIzol. The expression of six p53 isoforms, the short nuclear RNA U6 and genes related to cell senescence were measured by RT-PCR. Additionally, global mRNA sequencing (RNA-Seq) was performed, and intron retention was analyzed using IRFinder. Results and conclusions: In the intron retention analysis, no significant differences were found in the percentage of intron retention (control: 7.8%, WRS1: 6.3% and WRS2: 8.14%). The genes with more intron retention are mainly related to pathways related to RNA binding, cell cycle regulation, positive regulation of transcription, positive regulation of pathways related to inflammation, negative regulation of apoptosis, RNA transcription, mitochondria, and regulation of translation initiation. The genes with more intron retention in WRS patients are related to the immune response and mitochondrial function, while those with more retained introns in the control are related to the response to oxidative stress. Patient WRS1 showed a higher expression of short nuclear RNA U6 compared to control and patient WRS2. Fibroblasts from patients with WRS express a higher percentage of p53 and a lower percentage of 133p53, consistent with a higher expression of the cellular senescence markers p16 and p21. These results highlight the importance of an adequate function of RNA polymerase III in the maintenance of cellular homeostasis, mainly in the splicing and DNA repair processes.MaestríaMagíster en Genética Humana4.1 Tipo de estudio Estudio experimental llevado a cabo en fibroblastos obtenidos de dos pacientes con Síndrome de Wiedemann-Rautenstrauch y un control sano. 4.2 Descripción de las pacientes La paciente WRS1 es una paciente de sexo femenino de 21 años de edad, natural y procedente de Bogotá, con fenotipo concordante con el Síndrome de Wiedemann-Rautenstrauch y con hallazgo de una variante patogénica heredada de la madre en el gen POLR3A (c. 3772_2773delCT; p.Leu1258Glyfs*12). Esta variante está clasificada como una variante patogénica debido a que cumple con los criterios de patogenicidad de las guías del Colegio Americano de Genética Médica (ACMG): PVS1, PP5 y PM2, y no cumple con ningún criterio de benignidad. La paciente WRS2 es una paciente de sexo femenino de 6 años de edad, natural y procedente de Bogotá, con fenotipo concordante con el Síndrome de Wiedemann-Rautenstrauch y con hallazgo de una variante patogénica heredada del padre en el gen POLR3A (c.3G>T; p.Met1Leu*). Esta variante está clasificada como una variante patogénica debido a que cumple con los criterios de patogenicidad de las guías del ACMG: PVS1, PP5 y PM2, y no cumple con ningún criterio de benignidad. El control es una persona sana de sexo femenino de 21 años de edad. 4.3 Obtención de fibroblastos Previo consentimiento informado se tomó una biopsia de piel de la parte interna del brazo de dos pacientes femeninas con Síndrome de Wiedemann-Rautenstrauch en la primera y en la tercera década de la vida y de un control sano. Para obtener la muestra se desinfectó el área con alcohol al 70% y se extrajó un fragmento de piel de la zona deseada usando el punch y las pinzas de disección, luego se suturó la herida con un punto. Posteriormente, la muestra recogida fue colocada en un tubo falcon de 15 mL con 12 mL de medio suplementado previamente atemperado a 37°C. Después, en la cabina de flujo, se retiró el medio en el cual se encontraba la biopsia y se realizaron tres lavados con PBS 1X al 1% de penicilina/estreptomicina estéril con movimientos rotatorios y se descartó el sobrenadante. Luego, en una caja de Petri de 100 mm se añadieron 3 mL de PBS 1X, 3 mL de medio suplementado y el fragmento de piel. Una vez sumergida, la muestra se fragmentó en 12 a 18 trozos con una hoja de bisturí anclado a un mango adecuado. Una vez ya obtenidos los fragmentos, se retiró cuidadosamente el medio circundante y se agregaron 3 mL de tripsina-EDTA al 0.25% y se dejó incubando durante 5 minutos a 37°C. Posteriormente, se inactivó la tripsina con 10 mL de medio suplementado en un tubo falcon de 15 mL. Se centrifugó el contenido del tubo a 1000 rpm durante tres minutos, se descartó el sobrenadante y se resuspendió en 8 mL de medio suplementado fresco. El contenido del tubo falcon fue dividido en dos partes iguales y transferido a dos frascos T25 que se dejaron incubando a 37°C y 5% de CO2. Se cambió el medio cada 24 horas aproximadamente. Los fibroblastos alcanzaron un porcentaje de confluencia cercano al 70% a los 25-30 días. 4.4 Extracción de ARN Alrededor de 30 días después de la obtención de la biopsia, una vez las células alcanzaron un porcentaje alto de confluencia, se extrajo el ARN con TRIzol para los análisis posteriores. Las células fueron lisadas usando el reactivo TRIzol durante 5-10 minutos, con el objetivo de permitir la disociación completa de los complejos de nucleoproteína. Después se pasó el lisado celular a un eppendorf de 1.5 mL, se centrifugó a 14mil rpm durante diez minutos y se transfirió el sobrenadante a un tubo nuevo. Luego se agregaron 200 µL de cloroformo por cada mL de reactivo TRIzol y se agitó vigorosamente a mano durante 15 segundos. Posteriormente, se dejó incubando a temperatura ambiente durante 10 minutos y se centrifugó a 12mil gravedades durante 15 minutos a 4 grados Celsius. Después de la centrifugación, la fase acuosa, que contiene el ARN se transfirió a un tubo nuevo y el ARN se precipitó agregando 500 µL de alcohol isopropílico. Las muestras se dejaron incubando a temperatura ambiente durante 10 minutos y se centrifugaron a 12 mil gravedades durante 10 minutos a 4 grados Celsius. Después se removió el sobrenadante y se lavó el pellet de ARN con 1 mL de etanol al 75% en agua DEPC mezclando con vórtex. Luego, se centrifugó a 7500 gravedades durante 8 minutos a 4 grados Celsius, se removió el sobrenadante y se secó el ARN durante 5 minutos. Una vez seco, el ARN fue disuelto en 50 µL de agua DEPC. Las muestras fueron cuantificadas usando NanoDrop. Este proceso se realizó por triplicado. 4.5 Análisis de expresión global de ARN (RNA-Seq) El ARN extraído fue llevado a secuenciación de nueva generación de ARNs con secuencia de poliA utilizando un equipo Illumina. Los datos del RNA-Seq fueron entregados en formato FASTA y con las secuencias de adaptadores eliminadas. Las secuencias fueron alineadas usando STAR aligner v27.0a, utilizando como genoma de referencia y como genoma de anotación la secuencia del genoma humano GRCh38. Una vez concluido el proceso de alineación, se obtuvieron los archivos BAM unsorted, luego estos archivos fueron subidos al programa IRFinder, en dónde se obtuvieron los resultados de la medición retención de intrones global en archivos de texto, como la proporción de retención de intrones, que es igual a la abundancia de intrones sobre la abundancia de intrones más exones (Middleton, et al., 2017). Luego se realizó el análisis diferencial de la retención de intrones en DESeq2 en una interfaz R, siguiendo las instrucciones del manual de IRFinder. Después se analizaron las vías metabólicas en las que participan los genes con una retención de intrones diferencial utilizando las bases de datos de ontología genética y KEGG (Zheng, et al., 2020), utilizando DAVID. 4.6 Medición de la expresión relativa del ARN corto nuclear U6, de las diferentes isoformas de p53 y de otros genes relacionados con el empalme o la senescencia celular El ARN extraído y previamente cuantificado fue utilizado para realizar síntesis de ADN complementario mediante un proceso de transcripción reversa utilizando el kit Superscript III de Invitrogen. Se agregó el volumen equivalente a 5 µg de ARN en un tubo de PCR (reacción en cadena de la polimerasa) libre de ARNasas y luego se añadieron los otros componentes de la mezcla para alcanzar una concentración final de 10 M de primers de hexámeros al azar, 0.5 mM de deoxinucleotidos trifosfato (dNTPs), 1X de buffer, 0.5 UI de transcriptasa reversa, 40 UI de RNase OUT y se completó el volumen con agua DEPC hasta alcanzar 10 µL. La mezcla se dejó incubando a temperatura ambiente durante 5 minutos. En el termociclador se inició con un periodo de 2 minutos a 94 grados Celsius, con el objetivo de alcanzar la denaturación completa del ARN y después se realizaron 40 ciclos de denaturación (94 grados Celsius durante 45 segundos), anillaje (60 grados Celsius durante 30 segundos) y extensión (72 grados Celsius durante 40 segundos), finalmente se dejó incubando la muestra a 4 grados Celsius. El ADN complementario obtenido fue cuantificado usando NanoDrop. Una vez obtenido el ADN complementario se midió la expresión relativa de las isoformas de p53, de U2AF1, p16, p21, GSTM1 y del ARN corto nuclear U6 usando los primers nombrados en la tabla 2. Para la cuantificación de la expresión de GSTM1, p16, p21 y U2AF1 se usó como gen control el de la gliceraldehído-3-fosfato-deshidrogenasa (GAPDH), en el caso del ARN corto nuclear U6, se usó el gen de ARN corto nuclear U48 (RNU48) y en el caso de las isoformas de p53 se utilizó como gen de referencia el de la beta-actina. Tabla 2 Primers utilizados para medir la expresión relativa del ARN corto nuclear U6, de las diferentes isoformas de p53 y de genes relacionados con el empalme y la senescencia celular. ARN corto nuclear U6 Primer Forward 5’-CAGCACATATACTAAAATTGGAACG-3’ Primer Reverse 5’-ACGAATTTGCGTGTCATCC-3’ Gen control: ARN corto nuclear U48 Primer Forward 5′-TGATGATGACCCCAGGTAACTC-3′ Primer Reverse 5′-GAGCGCTGCGGTGATG-3 Isoformas de p53 Primer Forward (e2.1-exón 2) 5’ -GTCACTGCCATGGAGGAGCCGCA-3’ Primer Forward (e2-exón 2) 5’- ATGGAGGAGCCGCAGTCAGAT-3’ Primer Forward (i4FI-intrón 4) 5’- TAGACGCCAACTCTCTCTAG -3’ Primer Forward (i4F2–intrón 4) 5’- CTAGTGGGTTGCAGGAGGTGCTTACAC-3’ Primer Reverse (RT1-exón 11) 5’- GACGCACACCTATTGCAAGCAAGGGTTC -3’ Primer Reverse (RT2-exón 11) 5’- ATGTCAGTCTGAGTCAGGCCCTTCTGTC -3’ Primer Reverse (p53b-exón 9b) 5’- TTTGAAAGCTGGTCTGGTCCTGA-3’ Primer Reverse (p53g-exón 9g) 5’- TCGTAAGTCAAGTAGCATCTGAAGG-3’ Gen control: actina Primer Forward 5’-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3’ Primer Reverse 5’-CGTCATACTCCTGCTTGCTGATCCACATCTGC-3’ Glutatión-S-Transferasa 1 (GSTM1) Primer Forward 5’- TACTCTGAGCCCTGCTCGGT-3 Primer Reverse 5’- TGTATTCCAGGAGCAGGCGG-3’ p16 Primer Forward 5'-CCAACGCACCGAATAGTTACG-3' Primer Reverse 5'-GCGCTGCCCATCATCATG-3' p21 Primer Forward 5'-TGGAGACTCTCAGGGTCGAAA-3' Primer Reverse 5'-AGATGGTGATGGGCTTCCC-3' U2AF1 (Factor auxiliar del ARN corto nuclear U2 tipo 1) Primer Forward 5’- CCAGTCTGCTGACGGTTTG-3 Primer Reverse 5’- AGGTGGTCTCCCAGGTTGT-3 Gen control: gliceraldehído-3-fosfato-deshidrogenasa (GAPDH) Primer Forward 5’- TGGTATCGTGGAAGGACTCA-3´ Primer Reverse 5’-CCAGTAGAGGCAGGGATGAT-3´ Para medir la expresión relativa del ARN corto nuclear U6, de GSTM1, de U2AF1, de p16 y de p21, se realizó una PCR en tiempo real en el CFX96 Touch Real-Time PCR Detection System (BioRad) midiendo la fluorescencia utilizando SYBR-Green y realizando 48 ciclos de denaturación, anilaje y extensión. El análisis de los resultados se realizó siguiendo el método Ct. Para medir la expresión relativa de las isoformas de p53 se realizó una PCR anidada utilizando el ADN complementario obtenido y realizando las reacciones establecidas en la Tabla 3. El análisis de los resultados se realizó siguiendo el método Ct. Tabla 3 Primers específicos utilizados en cada reacción de PCR anidada para medir la expresión relativa de 6 isoformas de p53. Adaptado de: Khoury, M. P., Marcel, V., Fernandes, K., Diot, A., Lane, D. P., & Bourdon, J. C. (2013). Detecting and quantifying p53 isoforms at mRNA level in cell lines and tissues. In p53 Protocols (pp. 1-14). Humana Press, Totowa, NJ. 4.7 Verificación del análisis de retención de intrones Para la verificación del análisis de retención de intrones se realizó una electroforesis en un gel de agarosa al 2% de los productos de PCR utilizando los primers descritos en la Tabla 4. Tabla 4 Primers utilizados para la verificación del análisis de retención de intrones PILRB (Receptor beta tipo 2 tipo inmunoglobulina emparejado) Primer Forward 5-‘ ATCCCCTGTTAGAGACGGGC-3’ Primer Reverse 5’- GAACTCAGGCATAGGGGAGC-3’ K7EP35 (NADH Deshidrogenasa 1 Alfa Subunidad 11) Primer Forward 5’-CCTGTCTGCTGTGATTCAGG-3’ Primer Reverse 5’-GGAGGTTGCAGTGAGCTGAG-3’ Glutatión-S-Transferasa 1 (GSTM1) Primer Forward 5’-TTAGGCCTGTCTGCGGAATC-3’ Primer Reverse 5’-GAGATGGAGGGTCCCTGACT-3’ OAS1 (2'-5'-oligoadenilato sintetasa 1) Primer Forward 5’-CCTCCAGCTGCAACCATG-3’ Primer Reverse 5’-GTCTGCTTCCTAGCCATCTG-3’Síndromes progeroidesxvii, 52 páginasapplication/pdfspaUniversidad Nacional de ColombiaBogotá - Medicina - Maestría en Genética HumanaFacultad de MedicinaBogotá,ColombiaUniversidad Nacional de Colombia - Sede Bogotá610 - Medicina y saludSíndrome de Beckwith-WiedemannBeckwith-Wiedemann SyndromeDeoxyribonucleic acid DNAGenetic codeADNCódigo genéticosíndromes progeroidesEnvejecimientoEmpalmeIntronesp53Análisis de retención de intrones y de la expresión de isoformas de p53 en fibroblastos de pacientes con Síndrome de Wiedemann-RautenstrauchIntron retention analysis and differential expression analysis of p53 isoforms in fibroblasts from patients with Wiedemann-Rautenstrauch SyndromeTrabajo de grado - Maestríainfo:eu-repo/semantics/masterThesisinfo:eu-repo/semantics/acceptedVersionTexthttp://purl.org/redcol/resource_type/TMAbascal-Palacios, G., Ramsay, E. P., Beuron, F., Morris, E., & Vannini, A. (2018). Structural basis of RNA polymerase III transcription initiation. Nature, 553(7688), 301-306.Adusumalli, S., Ngian, Z. K., Lin, W. Q., Benoukraf, T., & Ong, C. T. (2019). Increased intron retention is a post‐transcriptional signature associated with progressive aging and Alzheimer’s disease. Aging cell, 18(3), e12928.Amaya-Montoya, M., Pérez-Londoño, A., Guatibonza-García, V., Vargas-Villanueva, A., & Mendivil, C. O. (2020). Cellular senescence as a therapeutic target for age-related diseases: a review. Advances in therapy, 37(4), 1407-1424.Arboleda, G., Ramírez, N., & Arboleda, H. (2007). The neonatal progeroid syndrome (Wiedemann–Rautenstrauch): A model for the study of human aging?. Experimental gerontology, 42(10), 939-943.Baez-Becerra, C. T., Valencia-Rincón, E., Velásquez-Méndez, K., Ramírez-Suárez, N. J., Guevara, C., Sandoval-Hernandez, A., ... & Arboleda, G. (2020). Nucleolar disruption, activation of P53 and premature senescence in POLR3A-mutated Wiedemann-Rautenstrauch Syndrome fibroblasts. Mechanisms of Ageing and Development, 192, 111360.Bhadra, M., Howell, P., Dutta, S., Heintz, C., & Mair, W. B. (2020). Alternative splicing in aging and longevity. Human genetics, 139(3), 357-369.Bourdon, J. C., Fernandes, K., Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas, D. P., ... & Lane, D. P. (2005). p53 isoforms can regulate p53 transcriptional activity. Genes & development, 19(18), 2122-2137.Carrero, D., Soria-Valles, C., & López-Otín, C. (2016). Hallmarks of progeroid syndromes: lessons from mice and reprogrammed cells. Disease models & mechanisms, 9(7), 719-735.Chan, W. M., & Poon, R. Y. (2007). The p53 isoform Δp53 lacks intrinsic transcriptional activity and reveals the critical role of nuclear import in dominant-negative activity. Cancer research, 67(5), 1959-1969.Chen, J., Zhang, D., Qin, X., Owzar, K., McCann, J. J., & Kastan, M. B. (2021). Dna-damage-induced alternative splicing of p53. Cancers, 13(2), 251.Christensen, K., Doblhammer, G., Rau, R., & Vaupel, J. W. (2009). Ageing populations: the challenges ahead. The lancet, 374(9696), 1196-1208.Deschênes, M., & Chabot, B. (2017). The emerging role of alternative splicing in senescence and aging. Aging cell, 16(5), 918-933.Didychuk, A. L., Butcher, S. E., & Brow, D. A. (2018). The life of U6 small nuclear RNA, from cradle to grave. RNA, 24(4), 437-460.Dvinge, H., Guenthoer, J., Porter, P. L., & Bradley, R. K. (2019). RNA components of the spliceosome regulate tissue-and cancer-specific alternative splicing. Genome research, 29(10), 1591-1604.Faustino, N. A., & Cooper, T. A. (2003). Pre-mRNA splicing and human disease. Genes & development, 17(4), 419-437.Fujita, K. (2019). P53 isoforms in cellular senescence-and ageing-associated biological and physiological functions. International journal of molecular sciences, 20(23), 6023.Fujita, K., Mondal, A. M., Horikawa, I., Nguyen, G. H., Kumamoto, K., Sohn, J. J., ... & Harris, C. C. (2009). p53 isoforms Δ133p53 and p53β are endogenous regulators of replicative cellular senescence. Nature cell biology, 11(9), 1135-1142.Gadea, G., Arsic, N., Fernandes, K., Diot, A., Joruiz, S. M., Abdallah, S., ... & Roux, P. (2016). TP53 drives invasion through expression of its Δ133p53β variant. Elife, 5, e14734.García‐Alai, M. M., Tidow, H., Natan, E., Townsley, F. M., Veprintsev, D. B., & Fersht, A. R. (2008). The novel p53 isoform “delta p53” is a misfolded protein and does not bind the p21 promoter site. Protein Science, 17(10), 1671-1678.Gudikote, J. P., Cascone, T., Poteete, A., Sitthideatphaiboon, P., Wu, Q., Morikawa, N., ... & Heymach, J. V. (2021). Inhibition of nonsense-mediated decay rescues p53β/γ isoform expression and activates the p53 pathway in MDM2-overexpressing and select p53-mutant cancers. Journal of Biological Chemistry, 297(5).Harries, L. W., Hernandez, D., Henley, W., Wood, A. R., Holly, A. C., Bradley‐Smith, R. M., ... & Melzer, D. (2011). Human aging is characterized by focused changes in gene expression and deregulation of alternative splicing. Aging cell, 10(5), 868-878.Heintz, C., Doktor, T. K., Lanjuin, A., Escoubas, C. C., Zhang, Y., Weir, H. J., ... & Mair, W. B. (2017). Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans. Nature, 541(7635), 102-106.Holly, A. C., Melzer, D., Pilling, L. C., Fellows, A. C., Tanaka, T., Ferrucci, L., & Harries, L. W. (2013). Changes in splicing factor expression are associated with advancing age in man. Mechanisms of ageing and development, 134(9), 356-366.Horikawa, I., Park, K. Y., Isogaya, K., Hiyoshi, Y., Li, H., Anami, K., ... & Harris, C. C. (2017). Δ133p53 represses p53-inducible senescence genes and enhances the generation of human induced pluripotent stem cells. Cell Death & Differentiation, 24(6), 1017-1028.Howe, M. P., Crerar, H., Neeves, J., Harley, J., Tyzack, G. E., Klein, P., ... & Luisier, R. (2022). Physiological intron retaining transcripts in the cytoplasm abound during human motor neurogenesis. Genome Research, 32(10), 1808-1825.Joruiz, S. M., & Bourdon, J. C. (2016). p53 isoforms: key regulators of the cell fate decision. Cold Spring Harbor perspectives in medicine, 6(8), a026039.Kulaberoglu, Y., Malik, Y., Borland, G., Selman, C., Alic, N., & Tullet, J. M. (2021). RNA polymerase III, ageing and longevity. Frontiers in Genetics, 12.Khoury, M. P., & Bourdon, J. C. (2011). p53 isoforms: an intracellular microprocessor?. Genes & cancer, 2(4), 453-465.Khoury, M. P., Marcel, V., Fernandes, K., Diot, A., Lane, D. P., & Bourdon, J. C. (2013). Detecting and quantifying p53 isoforms at mRNA level in cell lines and tissues. In p53 Protocols (pp. 1-14). Humana Press, Totowa, NJ.Kim, S., & An, S. S. A. (2016). Role of p53 isoforms and aggregations in cancer. Medicine, 95(26).Kumari, R., & Jat, P. (2021). Mechanisms of cellular senescence: cell cycle arrest and senescence associated secretory phenotype. Frontiers in Cell and Developmental Biology, 9, 485.Lee, Y., & Rio, D. C. (2015). Mechanisms and regulation of alternative pre-mRNA splicing. Annual review of biochemistry, 84, 291-323.Liu, S., Hua, Y., Wang, J., Li, L., Yuan, J., Zhang, B., ... & Kong, D. (2021). RNA polymerase III is required for the repair of DNA double-strand breaks by homologous recombination. Cell, 184(5), 1314-1329.López-Otín, C., Blasco, M. A., Partridge, L., Serrano, M., & Kroemer, G. (2013). The hallmarks of aging. Cell, 153(6), 1194-1217.Marcel, V., Perrier, S., Aoubala, M., Ageorges, S., Groves, M. J., Diot, A., ... & Bourdon, J. C. (2010). Δ160p53 is a novel N-terminal p53 isoform encoded by Δ133p53 transcript. FEBS letters, 584(21), 4463-4468.Mariotti, M., Kerepesi, C., Oliveros, W., Mele, M., & Gladyshev, V. N. (2022). Deterioration of the human transcriptome with age due to increasing intron retention and spurious splicing. bioRxiv.Middleton, R., Gao, D., Thomas, A., Singh, B., Au, A., Wong, J. J., ... & Ritchie, W. (2017). IRFinder: assessing the impact of intron retention on mammalian gene expression. Genome biology, 18(1), 1-11.Mondal, A. M., Horikawa, I., Pine, S. R., Fujita, K., Morgan, K. M., Vera, E., ... & Harris, C. C. (2013). p53 isoforms regulate aging-and tumor-associated replicative senescence in T lymphocytes. The Journal of clinical investigation, 123(12), 5247-5257.Okada, N., Oshima, K., Iwasaki, Y., Maruko, A., Matsumura, K., Iioka, E., ... & Nishimura, S. (2021). Intron retention as a new pre-symptomatic marker of aging and its recovery to the normal state by a traditional Japanese multi-herbal medicine. Gene, 794, 145752.Paolacci, S., Bertola, D., Franco, J., Mohammed, S., Tartaglia, M., Wollnik, B., & Hennekam, R. C. (2017). Wiedemann–Rautenstrauch syndrome: a phenotype analysis. American Journal of Medical Genetics Part A, 173(7), 1763-1772.Paolacci, S., Li, Y., Agolini, E., Bellacchio, E., Arboleda-Bustos, C. E., Carrero, D., ... & Hennekam, R. C. (2018). Specific combinations of biallelic POLR3A variants cause Wiedemann-Rautenstrauch syndrome. Journal of medical genetics, 55(12), 837-846.Petr, M. A., Tulika, T., Carmona-Marin, L. M., & Scheibye-Knudsen, M. (2020). Protecting the aging genome. Trends in Cell Biology, 30(2), 117-132.Singh, R. K., & Cooper, T. A. (2012). Pre-mRNA splicing in disease and therapeutics. Trends in molecular medicine, 18(8), 472-482.Tiku, V., & Antebi, A. (2018). Nucleolar function in lifespan regulation. Trends in cell biology, 28(8), 662-672.Turnquist, C., Horikawa, I., Foran, E., Major, E. O., Vojtesek, B., Lane, D. P., ... & Harris, C. C. (2016). p53 isoforms regulate astrocyte-mediated neuroprotection and neurodegeneration. Cell Death & Differentiation, 23(9), 1515-1528.Vanichkina, D. P., Schmitz, U., Wong, J. J. L., & Rasko, J. E. (2018, March). Challenges in defining the role of intron retention in normal biology and disease. In Seminars in cell & developmental biology (Vol. 75, pp. 40-49). Academic Press.Vasileiou, P. V., Evangelou, K., Vlasis, K., Panayiotidis, M. I., Chronopoulos, E., Passias, P. G., ... & Havaki, S. (2019). Mitochondrial homeostasis and cellular senescence. Cells, 8(7), 686.Vieler, M., & Sanyal, S. (2018). p53 isoforms and their implications in cancer. Cancers, 10(9), 288.von Muhlinen, N., Horikawa, I., Alam, F., Isogaya, K., Lissa, D., Vojtesek, B., ... & Harris, C. C. (2018). p53 isoforms regulate premature aging in human cells. Oncogene, 37(18), 2379-2393. .Wang, E. T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., ... & Burge, C. B. (2008). Alternative isoform regulation in human tissue transcriptomes. Nature, 456(7221), 470-476.Yang, K., Wang, M., Zhao, Y., Sun, X., Yang, Y., Li, X., ... & Yi, J. (2016). A redox mechanism underlying nucleolar stress sensing by nucleophosmin. Nature communications, 7(1), 1-16.Yao, J., Ding, D., Li, X., Shen, T., Fu, H., Zhong, H., ... & Ni, T. (2020). Prevalent intron retention fine‐tunes gene expression and contributes to cellular senescence. Aging Cell, 19(12), e13276.Zheng, J. T., Lin, C. X., Fang, Z. Y., & Li, H. D. (2020). Intron retention as a mode for RNA-seq data analysis. Frontiers in Genetics, 11, 586.Análisis funcional celular/molecular de la RNA polimerasa III A (POLR3A) asociado al Síndrome Progeroide Neonatal (Síndrome de Wiedemann-Rautenstrauch)MinCienciasLICENSElicense.txtlicense.txttext/plain; charset=utf-85879https://repositorio.unal.edu.co/bitstream/unal/84109/1/license.txteb34b1cf90b7e1103fc9dfd26be24b4aMD51ORIGINAL1026590616.2023.pdf1026590616.2023.pdfTesis de Maestría en Genética Humanaapplication/pdf1351048https://repositorio.unal.edu.co/bitstream/unal/84109/2/1026590616.2023.pdff975f25290e0cc1d82b07bd477e83352MD52THUMBNAIL1026590616.2023.pdf.jpg1026590616.2023.pdf.jpgGenerated Thumbnailimage/jpeg4637https://repositorio.unal.edu.co/bitstream/unal/84109/3/1026590616.2023.pdf.jpg84f452cb9e49f4fbdb2ff4f34492fea0MD53unal/84109oai:repositorio.unal.edu.co:unal/841092023-08-10 23:04:31.926Repositorio Institucional Universidad Nacional de Colombiarepositorio_nal@unal.edu.coUEFSVEUgMS4gVMOJUk1JTk9TIERFIExBIExJQ0VOQ0lBIFBBUkEgUFVCTElDQUNJw5NOIERFIE9CUkFTIEVOIEVMIFJFUE9TSVRPUklPIElOU1RJVFVDSU9OQUwgVU5BTC4KCkxvcyBhdXRvcmVzIHkvbyB0aXR1bGFyZXMgZGUgbG9zIGRlcmVjaG9zIHBhdHJpbW9uaWFsZXMgZGUgYXV0b3IsIGNvbmZpZXJlbiBhIGxhIFVuaXZlcnNpZGFkIE5hY2lvbmFsIGRlIENvbG9tYmlhIHVuYSBsaWNlbmNpYSBubyBleGNsdXNpdmEsIGxpbWl0YWRhIHkgZ3JhdHVpdGEgc29icmUgbGEgb2JyYSBxdWUgc2UgaW50ZWdyYSBlbiBlbCBSZXBvc2l0b3JpbyBJbnN0aXR1Y2lvbmFsLCBiYWpvIGxvcyBzaWd1aWVudGVzIHTDqXJtaW5vczoKCgphKQlMb3MgYXV0b3JlcyB5L28gbG9zIHRpdHVsYXJlcyBkZSBsb3MgZGVyZWNob3MgcGF0cmltb25pYWxlcyBkZSBhdXRvciBzb2JyZSBsYSBvYnJhIGNvbmZpZXJlbiBhIGxhIFVuaXZlcnNpZGFkIE5hY2lvbmFsIGRlIENvbG9tYmlhIHVuYSBsaWNlbmNpYSBubyBleGNsdXNpdmEgcGFyYSByZWFsaXphciBsb3Mgc2lndWllbnRlcyBhY3RvcyBzb2JyZSBsYSBvYnJhOiBpKSByZXByb2R1Y2lyIGxhIG9icmEgZGUgbWFuZXJhIGRpZ2l0YWwsIHBlcm1hbmVudGUgbyB0ZW1wb3JhbCwgaW5jbHV5ZW5kbyBlbCBhbG1hY2VuYW1pZW50byBlbGVjdHLDs25pY28sIGFzw60gY29tbyBjb252ZXJ0aXIgZWwgZG9jdW1lbnRvIGVuIGVsIGN1YWwgc2UgZW5jdWVudHJhIGNvbnRlbmlkYSBsYSBvYnJhIGEgY3VhbHF1aWVyIG1lZGlvIG8gZm9ybWF0byBleGlzdGVudGUgYSBsYSBmZWNoYSBkZSBsYSBzdXNjcmlwY2nDs24gZGUgbGEgcHJlc2VudGUgbGljZW5jaWEsIHkgaWkpIGNvbXVuaWNhciBhbCBww7pibGljbyBsYSBvYnJhIHBvciBjdWFscXVpZXIgbWVkaW8gbyBwcm9jZWRpbWllbnRvLCBlbiBtZWRpb3MgYWzDoW1icmljb3MgbyBpbmFsw6FtYnJpY29zLCBpbmNsdXllbmRvIGxhIHB1ZXN0YSBhIGRpc3Bvc2ljacOzbiBlbiBhY2Nlc28gYWJpZXJ0by4gQWRpY2lvbmFsIGEgbG8gYW50ZXJpb3IsIGVsIGF1dG9yIHkvbyB0aXR1bGFyIGF1dG9yaXphIGEgbGEgVW5pdmVyc2lkYWQgTmFjaW9uYWwgZGUgQ29sb21iaWEgcGFyYSBxdWUsIGVuIGxhIHJlcHJvZHVjY2nDs24geSBjb211bmljYWNpw7NuIGFsIHDDumJsaWNvIHF1ZSBsYSBVbml2ZXJzaWRhZCByZWFsaWNlIHNvYnJlIGxhIG9icmEsIGhhZ2EgbWVuY2nDs24gZGUgbWFuZXJhIGV4cHJlc2EgYWwgdGlwbyBkZSBsaWNlbmNpYSBDcmVhdGl2ZSBDb21tb25zIGJham8gbGEgY3VhbCBlbCBhdXRvciB5L28gdGl0dWxhciBkZXNlYSBvZnJlY2VyIHN1IG9icmEgYSBsb3MgdGVyY2Vyb3MgcXVlIGFjY2VkYW4gYSBkaWNoYSBvYnJhIGEgdHJhdsOpcyBkZWwgUmVwb3NpdG9yaW8gSW5zdGl0dWNpb25hbCwgY3VhbmRvIHNlYSBlbCBjYXNvLiBFbCBhdXRvciB5L28gdGl0dWxhciBkZSBsb3MgZGVyZWNob3MgcGF0cmltb25pYWxlcyBkZSBhdXRvciBwb2Ryw6EgZGFyIHBvciB0ZXJtaW5hZGEgbGEgcHJlc2VudGUgbGljZW5jaWEgbWVkaWFudGUgc29saWNpdHVkIGVsZXZhZGEgYSBsYSBEaXJlY2Npw7NuIE5hY2lvbmFsIGRlIEJpYmxpb3RlY2FzIGRlIGxhIFVuaXZlcnNpZGFkIE5hY2lvbmFsIGRlIENvbG9tYmlhLiAKCmIpIAlMb3MgYXV0b3JlcyB5L28gdGl0dWxhcmVzIGRlIGxvcyBkZXJlY2hvcyBwYXRyaW1vbmlhbGVzIGRlIGF1dG9yIHNvYnJlIGxhIG9icmEgY29uZmllcmVuIGxhIGxpY2VuY2lhIHNlw7FhbGFkYSBlbiBlbCBsaXRlcmFsIGEpIGRlbCBwcmVzZW50ZSBkb2N1bWVudG8gcG9yIGVsIHRpZW1wbyBkZSBwcm90ZWNjacOzbiBkZSBsYSBvYnJhIGVuIHRvZG9zIGxvcyBwYcOtc2VzIGRlbCBtdW5kbywgZXN0byBlcywgc2luIGxpbWl0YWNpw7NuIHRlcnJpdG9yaWFsIGFsZ3VuYS4KCmMpCUxvcyBhdXRvcmVzIHkvbyB0aXR1bGFyZXMgZGUgZGVyZWNob3MgcGF0cmltb25pYWxlcyBkZSBhdXRvciBtYW5pZmllc3RhbiBlc3RhciBkZSBhY3VlcmRvIGNvbiBxdWUgbGEgcHJlc2VudGUgbGljZW5jaWEgc2Ugb3RvcmdhIGEgdMOtdHVsbyBncmF0dWl0bywgcG9yIGxvIHRhbnRvLCByZW51bmNpYW4gYSByZWNpYmlyIGN1YWxxdWllciByZXRyaWJ1Y2nDs24gZWNvbsOzbWljYSBvIGVtb2x1bWVudG8gYWxndW5vIHBvciBsYSBwdWJsaWNhY2nDs24sIGRpc3RyaWJ1Y2nDs24sIGNvbXVuaWNhY2nDs24gcMO6YmxpY2EgeSBjdWFscXVpZXIgb3RybyB1c28gcXVlIHNlIGhhZ2EgZW4gbG9zIHTDqXJtaW5vcyBkZSBsYSBwcmVzZW50ZSBsaWNlbmNpYSB5IGRlIGxhIGxpY2VuY2lhIENyZWF0aXZlIENvbW1vbnMgY29uIHF1ZSBzZSBwdWJsaWNhLgoKZCkJUXVpZW5lcyBmaXJtYW4gZWwgcHJlc2VudGUgZG9jdW1lbnRvIGRlY2xhcmFuIHF1ZSBwYXJhIGxhIGNyZWFjacOzbiBkZSBsYSBvYnJhLCBubyBzZSBoYW4gdnVsbmVyYWRvIGxvcyBkZXJlY2hvcyBkZSBwcm9waWVkYWQgaW50ZWxlY3R1YWwsIGluZHVzdHJpYWwsIG1vcmFsZXMgeSBwYXRyaW1vbmlhbGVzIGRlIHRlcmNlcm9zLiBEZSBvdHJhIHBhcnRlLCAgcmVjb25vY2VuIHF1ZSBsYSBVbml2ZXJzaWRhZCBOYWNpb25hbCBkZSBDb2xvbWJpYSBhY3TDumEgY29tbyB1biB0ZXJjZXJvIGRlIGJ1ZW5hIGZlIHkgc2UgZW5jdWVudHJhIGV4ZW50YSBkZSBjdWxwYSBlbiBjYXNvIGRlIHByZXNlbnRhcnNlIGFsZ8O6biB0aXBvIGRlIHJlY2xhbWFjacOzbiBlbiBtYXRlcmlhIGRlIGRlcmVjaG9zIGRlIGF1dG9yIG8gcHJvcGllZGFkIGludGVsZWN0dWFsIGVuIGdlbmVyYWwuIFBvciBsbyB0YW50bywgbG9zIGZpcm1hbnRlcyAgYWNlcHRhbiBxdWUgY29tbyB0aXR1bGFyZXMgw7puaWNvcyBkZSBsb3MgZGVyZWNob3MgcGF0cmltb25pYWxlcyBkZSBhdXRvciwgYXN1bWlyw6FuIHRvZGEgbGEgcmVzcG9uc2FiaWxpZGFkIGNpdmlsLCBhZG1pbmlzdHJhdGl2YSB5L28gcGVuYWwgcXVlIHB1ZWRhIGRlcml2YXJzZSBkZSBsYSBwdWJsaWNhY2nDs24gZGUgbGEgb2JyYS4gIAoKZikJQXV0b3JpemFuIGEgbGEgVW5pdmVyc2lkYWQgTmFjaW9uYWwgZGUgQ29sb21iaWEgaW5jbHVpciBsYSBvYnJhIGVuIGxvcyBhZ3JlZ2Fkb3JlcyBkZSBjb250ZW5pZG9zLCBidXNjYWRvcmVzIGFjYWTDqW1pY29zLCBtZXRhYnVzY2Fkb3Jlcywgw61uZGljZXMgeSBkZW3DoXMgbWVkaW9zIHF1ZSBzZSBlc3RpbWVuIG5lY2VzYXJpb3MgcGFyYSBwcm9tb3ZlciBlbCBhY2Nlc28geSBjb25zdWx0YSBkZSBsYSBtaXNtYS4gCgpnKQlFbiBlbCBjYXNvIGRlIGxhcyB0ZXNpcyBjcmVhZGFzIHBhcmEgb3B0YXIgZG9ibGUgdGl0dWxhY2nDs24sIGxvcyBmaXJtYW50ZXMgc2Vyw6FuIGxvcyByZXNwb25zYWJsZXMgZGUgY29tdW5pY2FyIGEgbGFzIGluc3RpdHVjaW9uZXMgbmFjaW9uYWxlcyBvIGV4dHJhbmplcmFzIGVuIGNvbnZlbmlvLCBsYXMgbGljZW5jaWFzIGRlIGFjY2VzbyBhYmllcnRvIENyZWF0aXZlIENvbW1vbnMgeSBhdXRvcml6YWNpb25lcyBhc2lnbmFkYXMgYSBzdSBvYnJhIHBhcmEgbGEgcHVibGljYWNpw7NuIGVuIGVsIFJlcG9zaXRvcmlvIEluc3RpdHVjaW9uYWwgVU5BTCBkZSBhY3VlcmRvIGNvbiBsYXMgZGlyZWN0cmljZXMgZGUgbGEgUG9sw610aWNhIEdlbmVyYWwgZGUgbGEgQmlibGlvdGVjYSBEaWdpdGFsLgoKCmgpCVNlIGF1dG9yaXphIGEgbGEgVW5pdmVyc2lkYWQgTmFjaW9uYWwgZGUgQ29sb21iaWEgY29tbyByZXNwb25zYWJsZSBkZWwgdHJhdGFtaWVudG8gZGUgZGF0b3MgcGVyc29uYWxlcywgZGUgYWN1ZXJkbyBjb24gbGEgbGV5IDE1ODEgZGUgMjAxMiBlbnRlbmRpZW5kbyBxdWUgc2UgZW5jdWVudHJhbiBiYWpvIG1lZGlkYXMgcXVlIGdhcmFudGl6YW4gbGEgc2VndXJpZGFkLCBjb25maWRlbmNpYWxpZGFkIGUgaW50ZWdyaWRhZCwgeSBzdSB0cmF0YW1pZW50byB0aWVuZSB1bmEgZmluYWxpZGFkIGhpc3TDs3JpY2EsIGVzdGFkw61zdGljYSBvIGNpZW50w61maWNhIHNlZ8O6biBsbyBkaXNwdWVzdG8gZW4gbGEgUG9sw610aWNhIGRlIFRyYXRhbWllbnRvIGRlIERhdG9zIFBlcnNvbmFsZXMuCgoKClBBUlRFIDIuIEFVVE9SSVpBQ0nDk04gUEFSQSBQVUJMSUNBUiBZIFBFUk1JVElSIExBIENPTlNVTFRBIFkgVVNPIERFIE9CUkFTIEVOIEVMIFJFUE9TSVRPUklPIElOU1RJVFVDSU9OQUwgVU5BTC4KClNlIGF1dG9yaXphIGxhIHB1YmxpY2FjacOzbiBlbGVjdHLDs25pY2EsIGNvbnN1bHRhIHkgdXNvIGRlIGxhIG9icmEgcG9yIHBhcnRlIGRlIGxhIFVuaXZlcnNpZGFkIE5hY2lvbmFsIGRlIENvbG9tYmlhIHkgZGUgc3VzIHVzdWFyaW9zIGRlIGxhIHNpZ3VpZW50ZSBtYW5lcmE6CgphLglDb25jZWRvIGxpY2VuY2lhIGVuIGxvcyB0w6lybWlub3Mgc2XDsWFsYWRvcyBlbiBsYSBwYXJ0ZSAxIGRlbCBwcmVzZW50ZSBkb2N1bWVudG8sIGNvbiBlbCBvYmpldGl2byBkZSBxdWUgbGEgb2JyYSBlbnRyZWdhZGEgc2VhIHB1YmxpY2FkYSBlbiBlbCBSZXBvc2l0b3JpbyBJbnN0aXR1Y2lvbmFsIGRlIGxhIFVuaXZlcnNpZGFkIE5hY2lvbmFsIGRlIENvbG9tYmlhIHkgcHVlc3RhIGEgZGlzcG9zaWNpw7NuIGVuIGFjY2VzbyBhYmllcnRvIHBhcmEgc3UgY29uc3VsdGEgcG9yIGxvcyB1c3VhcmlvcyBkZSBsYSBVbml2ZXJzaWRhZCBOYWNpb25hbCBkZSBDb2xvbWJpYSAgYSB0cmF2w6lzIGRlIGludGVybmV0LgoKCgpQQVJURSAzIEFVVE9SSVpBQ0nDk04gREUgVFJBVEFNSUVOVE8gREUgREFUT1MgUEVSU09OQUxFUy4KCkxhIFVuaXZlcnNpZGFkIE5hY2lvbmFsIGRlIENvbG9tYmlhLCBjb21vIHJlc3BvbnNhYmxlIGRlbCBUcmF0YW1pZW50byBkZSBEYXRvcyBQZXJzb25hbGVzLCBpbmZvcm1hIHF1ZSBsb3MgZGF0b3MgZGUgY2Fyw6FjdGVyIHBlcnNvbmFsIHJlY29sZWN0YWRvcyBtZWRpYW50ZSBlc3RlIGZvcm11bGFyaW8sIHNlIGVuY3VlbnRyYW4gYmFqbyBtZWRpZGFzIHF1ZSBnYXJhbnRpemFuIGxhIHNlZ3VyaWRhZCwgY29uZmlkZW5jaWFsaWRhZCBlIGludGVncmlkYWQgeSBzdSB0cmF0YW1pZW50byBzZSByZWFsaXphIGRlIGFjdWVyZG8gYWwgY3VtcGxpbWllbnRvIG5vcm1hdGl2byBkZSBsYSBMZXkgMTU4MSBkZSAyMDEyIHkgZGUgbGEgUG9sw610aWNhIGRlIFRyYXRhbWllbnRvIGRlIERhdG9zIFBlcnNvbmFsZXMgZGUgbGEgVW5pdmVyc2lkYWQgTmFjaW9uYWwgZGUgQ29sb21iaWEuIFB1ZWRlIGVqZXJjZXIgc3VzIGRlcmVjaG9zIGNvbW8gdGl0dWxhciBhIGNvbm9jZXIsIGFjdHVhbGl6YXIsIHJlY3RpZmljYXIgeSByZXZvY2FyIGxhcyBhdXRvcml6YWNpb25lcyBkYWRhcyBhIGxhcyBmaW5hbGlkYWRlcyBhcGxpY2FibGVzIGEgdHJhdsOpcyBkZSBsb3MgY2FuYWxlcyBkaXNwdWVzdG9zIHkgZGlzcG9uaWJsZXMgZW4gd3d3LnVuYWwuZWR1LmNvIG8gZS1tYWlsOiBwcm90ZWNkYXRvc19uYUB1bmFsLmVkdS5jbyIKClRlbmllbmRvIGVuIGN1ZW50YSBsbyBhbnRlcmlvciwgYXV0b3Jpem8gZGUgbWFuZXJhIHZvbHVudGFyaWEsIHByZXZpYSwgZXhwbMOtY2l0YSwgaW5mb3JtYWRhIGUgaW5lcXXDrXZvY2EgYSBsYSBVbml2ZXJzaWRhZCBOYWNpb25hbCBkZSBDb2xvbWJpYSBhIHRyYXRhciBsb3MgZGF0b3MgcGVyc29uYWxlcyBkZSBhY3VlcmRvIGNvbiBsYXMgZmluYWxpZGFkZXMgZXNwZWPDrWZpY2FzIHBhcmEgZWwgZGVzYXJyb2xsbyB5IGVqZXJjaWNpbyBkZSBsYXMgZnVuY2lvbmVzIG1pc2lvbmFsZXMgZGUgZG9jZW5jaWEsIGludmVzdGlnYWNpw7NuIHkgZXh0ZW5zacOzbiwgYXPDrSBjb21vIGxhcyByZWxhY2lvbmVzIGFjYWTDqW1pY2FzLCBsYWJvcmFsZXMsIGNvbnRyYWN0dWFsZXMgeSB0b2RhcyBsYXMgZGVtw6FzIHJlbGFjaW9uYWRhcyBjb24gZWwgb2JqZXRvIHNvY2lhbCBkZSBsYSBVbml2ZXJzaWRhZC4gCgo=

Publicaciones similares